Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATAGGTATCCTGCGTGGTTTTCTG[A/G]TTTAACAGTATCTCACTTTTGTTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611298 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C1orf194 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C1orf194 - chromosome 1 open reading frame 194 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122961.1 | 778 | Silent Mutation | AAC,AAT | N,N 84 | NP_001116433.1 | |
XM_005270448.3 | 778 | Silent Mutation | AAC,AAT | N,N 45 | XP_005270505.1 | |
XM_006710342.3 | 778 | Silent Mutation | AAC,AAT | N,N 195 | XP_006710405.1 | |
XM_006710343.3 | 778 | Silent Mutation | AAC,AAT | N,N 156 | XP_006710406.1 | |
XM_011540647.2 | 778 | Silent Mutation | AAC,AAT | N,N 205 | XP_011538949.1 | |
XM_011540648.1 | 778 | Intron | XP_011538950.1 |
KIAA1324 - KIAA1324 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCARNA2 - small Cajal body-specific RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |