Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCAGAGCTCTGGGGTCTGTGGC[A/G]GTGGGACCTACGGCGCCTGTGGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 612604 MIM: 612605 MIM: 612606 | ||||||||||||||||||||
Literature Links: |
LCE1B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LCE1B - late cornified envelope 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LCE1C - late cornified envelope 1C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001276331.1 | 220 | Missense Mutation | CGC,TGC | R,C 57 | NP_001263260.1 | |
NM_178351.3 | 220 | Missense Mutation | CGC,TGC | R,C 87 | NP_848128.1 |
LCE1D - late cornified envelope 1D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |