Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAAGCGTTGTTCCATCAAAGCTGAG[C/T]GGCAGCTGAGGGCAGGAAGGAATAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607138 MIM: 604671 MIM: 602672 MIM: 604740 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CREB3L4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CREB3L4 - cAMP responsive element binding protein 3 like 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001255978.1 | 1013 | Intron | NP_001242907.1 | |||
NM_001255979.1 | 1013 | Intron | NP_001242908.1 | |||
NM_001255980.1 | 1013 | Intron | NP_001242909.1 | |||
NM_001255981.1 | 1013 | Intron | NP_001242910.1 | |||
NM_130898.3 | 1013 | Intron | NP_570968.1 | |||
XM_006711172.2 | 1013 | Intron | XP_006711235.1 | |||
XM_017000372.1 | 1013 | Intron | XP_016855861.1 |
JTB - jumping translocation breakpoint | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006694.3 | 1013 | Missense Mutation | CAC,CGC | H,R 97 | NP_006685.1 |
RAB13 - RAB13, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC39A1 - solute carrier family 39 member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |