Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGGCATGGAGCCTCCTGGAGACT[G/C]GGGGCCTCCTCCCTGGAGATCCACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602746 | ||||||||||||||||||||
Literature Links: |
LOC100996583 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100996583 - uncharacterized LOC100996583 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC115110 - uncharacterized LOC115110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF14 - TNF receptor superfamily member 14 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297605.1 | 320 | Missense Mutation | TCG,TGG | S,W 7 | NP_001284534.1 | |
NM_003820.3 | 320 | Missense Mutation | TCG,TGG | S,W 7 | NP_003811.2 | |
XM_006711019.2 | 320 | Missense Mutation | TCG,TGG | S,W 7 | XP_006711082.1 | |
XM_011542383.2 | 320 | Intron | XP_011540685.1 | |||
XM_017002718.1 | 320 | Intron | XP_016858207.1 | |||
XM_017002719.1 | 320 | Intron | XP_016858208.1 | |||
XM_017002720.1 | 320 | UTR 5 | XP_016858209.1 | |||
XM_017002721.1 | 320 | UTR 5 | XP_016858210.1 |