Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCAGCTTCTGGCGTCTTCGGTCGA[C/T]GGCGGCACCTCCAGCAGCAGCTGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603905 MIM: 600315 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
TNFRSF18 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
TNFRSF18 - TNF receptor superfamily member 18 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004195.2 | 747 | Silent Mutation | CCA,CCG | P,P 210 | NP_004186.1 | |
NM_148901.1 | 747 | Missense Mutation | CAT,CGT | H,R 140 | NP_683699.1 | |
NM_148902.1 | 747 | Silent Mutation | CCA,CCG | P,P 203 | NP_683700.1 | |
XM_017002722.1 | 747 | Missense Mutation | CAT,CGT | H,R 232 | XP_016858211.1 |
TNFRSF4 - TNF receptor superfamily member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTLL10 - tubulin tyrosine ligase like 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |