Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCATACTTACCTGCATACATATCT[A/T]TATCTCTGTCCAGTGTGGTGAATTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603874 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANGPTL1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANGPTL1 - angiopoietin like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004673.3 | 1750 | Missense Mutation | AAA,ATA | K,I 425 | NP_004664.1 | |
XM_005245577.2 | 1750 | Missense Mutation | AAA,ATA | K,I 425 | XP_005245634.1 |
RALGPS2 - Ral GEF with PH domain and SH3 binding motif 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286247.1 | 1750 | Intron | NP_001273176.1 | |||
NM_152663.4 | 1750 | Intron | NP_689876.2 | |||
XM_006711410.3 | 1750 | Intron | XP_006711473.1 | |||
XM_006711411.3 | 1750 | Intron | XP_006711474.1 | |||
XM_011509688.1 | 1750 | Intron | XP_011507990.1 | |||
XM_017001591.1 | 1750 | Intron | XP_016857080.1 |