Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGAAGTGCTGACAGCGGCTGTGG[G/A]GTATGGGCTGGAGGAACTGAGAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602913 MIM: 603673 MIM: 611713 | ||||||||||||||||||||
Literature Links: |
BTBD19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BTBD19 - BTB domain containing 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136537.1 | 668 | Missense Mutation | GAG,GGG | E,G 110 | NP_001130009.1 | |
XM_006710386.3 | 668 | Missense Mutation | GAG,GGG | E,G 110 | XP_006710449.1 | |
XM_011540803.2 | 668 | Silent Mutation | GGA,GGG | G,G 152 | XP_011539105.1 | |
XM_011540805.2 | 668 | Silent Mutation | GGA,GGG | G,G 152 | XP_011539107.1 | |
XM_017000447.1 | 668 | Silent Mutation | GGA,GGG | G,G 152 | XP_016855936.1 | |
XM_017000448.1 | 668 | Missense Mutation | GAG,GGG | E,G 110 | XP_016855937.1 | |
XM_017000449.1 | 668 | Silent Mutation | GGA,GGG | G,G 152 | XP_016855938.1 |
PLK3 - polo like kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTCH2 - patched 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCTEX1D4 - Tctex1 domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013632.3 | 668 | Intron | NP_001013654.1 |