Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCCAGCTGTGCCCTGCCGGTGCT[G/T]CCAGGAGCACGGTCCGGGCCTAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 134629 | ||||||||||||||||||||
Literature Links: |
FDPS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FDPS - farnesyl diphosphate synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105371451 - uncharacterized LOC105371451 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUSC1 - RUN and SH3 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001105203.1 | 450 | Missense Mutation | TGC,TTC | C,F 74 | NP_001098673.1 | |
NM_001105204.1 | 450 | Missense Mutation | TGC,TTC | C,F 74 | NP_001098674.1 | |
NM_001105205.1 | 450 | Intron | NP_001098675.1 | |||
NM_001278227.1 | 450 | Intron | NP_001265156.1 | |||
NM_001278228.1 | 450 | Intron | NP_001265157.1 | |||
NM_001278229.1 | 450 | Intron | NP_001265158.1 | |||
NM_001278230.1 | 450 | Intron | NP_001265159.1 | |||
NM_014328.4 | 450 | Intron | NP_055143.2 | |||
XM_006711254.1 | 450 | Missense Mutation | TGC,TTC | C,F 74 | XP_006711317.1 | |
XM_006711256.1 | 450 | Missense Mutation | TGC,TTC | C,F 74 | XP_006711319.1 | |
XM_006711257.1 | 450 | Intron | XP_006711320.1 | |||
XM_017000891.1 | 450 | Missense Mutation | TGC,TTC | C,F 74 | XP_016856380.1 | |
XM_017000892.1 | 450 | Intron | XP_016856381.1 |
RUSC1-AS1 - RUSC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039517.1 | 450 | Intron | NP_001034606.1 |