Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACAATCCCAGGGCCACAGCGCC[G/A]GAGGCCTAGTTTGTCCAGAGGAATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612875 MIM: 604042 MIM: 603867 MIM: 605313 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GNRHR2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GNRHR2 - gonadotropin releasing hormone receptor 2 (pseudogene) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITGA10 - integrin subunit alpha 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PEX11B - peroxisomal biogenesis factor 11 beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184795.1 | 724 | Missense Mutation | NP_001171724.1 | |||
NM_003846.2 | 724 | Missense Mutation | NP_003837.1 |
RBM8A - RNA binding motif protein 8A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |