Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGCTGCAAGCTCAGACAGTGGC[C/T]GCAGTGGCCGTGGGACACCAGCACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609613 MIM: 610817 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PLEKHM2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PLEKHM2 - pleckstrin homology and RUN domain containing M2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A34 - solute carrier family 25 member 34 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207348.2 | 1809 | Silent Mutation | GCC,GCT | A,A 137 | NP_997231.1 | |
XM_011541292.2 | 1809 | Silent Mutation | GCC,GCT | A,A 137 | XP_011539594.1 | |
XM_011541293.1 | 1809 | Silent Mutation | GCC,GCT | A,A 137 | XP_011539595.1 | |
XM_017001083.1 | 1809 | Silent Mutation | GCC,GCT | A,A 137 | XP_016856572.1 |
TMEM82 - transmembrane protein 82 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |