Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGGTCCTAGTGGAGAGCAGTGAG[C/T]GTCTGGGAGGCTGGATTCGCTCCGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604014 MIM: 600923 MIM: 610554 MIM: 604729 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
B4GALT3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
B4GALT3 - beta-1,4-galactosyltransferase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPOX - protoporphyrinogen oxidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000309.3 | 238 | Missense Mutation | CGT,TGT | R,C 38 | NP_000300.1 | |
NM_001122764.1 | 238 | Missense Mutation | CGT,TGT | R,C 38 | NP_001116236.1 | |
XM_005245291.3 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_005245348.2 | |
XM_005245295.3 | 238 | UTR 5 | XP_005245352.2 | |||
XM_006711402.2 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_006711465.2 | |
XM_006711403.2 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_006711466.2 | |
XM_006711404.3 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_006711467.2 | |
XM_006711406.2 | 238 | UTR 5 | XP_006711469.2 | |||
XM_011509663.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507965.1 | |
XM_011509664.1 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507966.1 | |
XM_011509665.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507967.1 | |
XM_011509666.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507968.1 | |
XM_011509667.2 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_011507969.1 | |
XM_011509668.2 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_011507970.1 | |
XM_011509669.1 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_011507971.1 | |
XM_011509670.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507972.1 | |
XM_011509671.1 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507973.1 | |
XM_011509672.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507974.1 | |
XM_011509673.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507975.1 | |
XM_011509674.2 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_011507976.1 | |
XM_011509675.2 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_011507977.1 | |
XM_011509676.1 | 238 | UTR 5 | XP_011507978.1 | |||
XM_011509677.1 | 238 | UTR 5 | XP_011507979.1 | |||
XM_011509678.1 | 238 | UTR 5 | XP_011507980.1 | |||
XM_011509679.1 | 238 | UTR 5 | XP_011507981.1 | |||
XM_011509681.1 | 238 | UTR 5 | XP_011507983.1 | |||
XM_011509682.1 | 238 | UTR 5 | XP_011507984.1 | |||
XM_017001559.1 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_016857048.1 | |
XM_017001560.1 | 238 | Missense Mutation | CGT,TGT | R,C 38 | XP_016857049.1 | |
XM_017001561.1 | 238 | UTR 5 | XP_016857050.1 | |||
XM_017001562.1 | 238 | UTR 5 | XP_016857051.1 | |||
XM_017001563.1 | 238 | UTR 5 | XP_016857052.1 | |||
XM_017001564.1 | 238 | Intron | XP_016857053.1 | |||
XM_017001565.1 | 238 | UTR 5 | XP_016857054.1 | |||
XM_017001566.1 | 238 | UTR 5 | XP_016857055.1 | |||
XM_017001567.1 | 238 | UTR 5 | XP_016857056.1 | |||
XM_017001568.1 | 238 | UTR 5 | XP_016857057.1 | |||
XM_017001569.1 | 238 | UTR 5 | XP_016857058.1 | |||
XM_017001570.1 | 238 | UTR 5 | XP_016857059.1 | |||
XM_017001571.1 | 238 | Missense Mutation | CGT,TGT | R,C 76 | XP_016857060.1 |
UFC1 - ubiquitin-fold modifier conjugating enzyme 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP21 - ubiquitin specific peptidase 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |