Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGTCATCATCCCCTTTAGACACCG[G/T]GAACACCACCTGCGCTACTGGCTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603717 MIM: 604013 MIM: 603456 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6V0B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP6V0B - ATPase H+ transporting V0 subunit b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
B4GALT2 - beta-1,4-galactosyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005417.2 | 625 | Silent Mutation | CGG,CGT | R,R 154 | NP_001005417.1 | |
NM_003780.4 | 625 | Silent Mutation | CGG,CGT | R,R 154 | NP_003771.1 | |
NM_030587.2 | 625 | Silent Mutation | CGG,CGT | R,R 183 | NP_085076.2 | |
XM_017002716.1 | 625 | Silent Mutation | CGG,CGT | R,R 154 | XP_016858205.1 | |
XM_017002717.1 | 625 | Silent Mutation | CGG,CGT | R,R 154 | XP_016858206.1 |
CCDC24 - coiled-coil domain containing 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DPH2 - DPH2 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |