Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGAGCACCTGCGCGAGCAGACGG[C/T]GCTCATGATGCAGAGCTTCGGCGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611539 | ||||||||||||||||||||
Literature Links: |
FOXD3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FOXD3 - forkhead box D3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012183.2 | 749 | Missense Mutation | GCG,GTG | A,V 250 | NP_036315.1 |
FOXD3-AS1 - FOXD3 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC00466 - long intergenic non-protein coding RNA 466 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6068 - microRNA 6068 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |