Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGCTGCTCGAAGTGTAGTAAGAA[A/G]AATTGGGACCAACCTACCCTTGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
12 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606210 | ||||||||||||||||||||
Literature Links: |
AUNIP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AUNIP - aurora kinase A and ninein interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC646471 - uncharacterized LOC646471 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTFR1L - mitochondrial fission regulator 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099625.1 | 290 | Missense Mutation | AAA,AGA | K,R 27 | NP_001093095.1 | |
NM_001099626.1 | 290 | Missense Mutation | AAA,AGA | K,R 27 | NP_001093096.1 | |
NM_001099627.1 | 290 | Missense Mutation | AAA,AGA | K,R 27 | NP_001093097.1 | |
NM_019557.5 | 290 | Missense Mutation | AAA,AGA | K,R 27 | NP_062457.3 |
SEPN1 - selenoprotein N, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |