Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATGGTGCCAACCTGGAAGCAGCTG[C/T]CCCCTGCCACTCCTGTAACCTGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 613665 MIM: 609743 | ||||||||||||||||||||
Literature Links: |
ACKR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACKR1 - atypical chemokine receptor 1 (Duffy blood group) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122951.2 | 327 | Missense Mutation | GCC,GTC | A,V 51 | NP_001116423.1 | |
NM_002036.3 | 327 | Missense Mutation | GCC,GTC | A,V 49 | NP_002027.2 |
CADM3 - cell adhesion molecule 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CADM3-AS1 - CADM3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |