Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGCCCAGATCAAAGGTGCGGCCT[C/G]GTACCTGTGCCTGGCACTGCCCGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 615689 | ||||||||||||||||||||
Literature Links: |
AMIGO1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AMIGO1 - adhesion molecule with Ig like domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATXN7L2 - ataxin 7 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CYB561D1 - cytochrome b561 family member D1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134400.1 | 1850 | Missense Mutation | TCG,TGG | S,W 221 | NP_001127872.1 | |
NM_001134402.1 | 1850 | Missense Mutation | TCG,TGG | S,W 142 | NP_001127874.1 | |
NM_001134403.1 | 1850 | UTR 3 | NP_001127875.1 | |||
NM_001134404.1 | 1850 | UTR 3 | NP_001127876.1 | |||
NM_182580.2 | 1850 | Missense Mutation | TCG,TGG | S,W 199 | NP_872386.1 | |
XM_005270775.2 | 1850 | Missense Mutation | TCG,TGG | S,W 161 | XP_005270832.1 | |
XM_005270776.3 | 1850 | Missense Mutation | TCG,TGG | S,W 141 | XP_005270833.1 | |
XM_005270777.2 | 1850 | Missense Mutation | TCG,TGG | S,W 133 | XP_005270834.1 | |
XM_011541286.2 | 1850 | Missense Mutation | TCG,TGG | S,W 161 | XP_011539588.1 | |
XM_011541287.2 | 1850 | Missense Mutation | TCG,TGG | S,W 260 | XP_011539589.2 | |
XM_017001078.1 | 1850 | Missense Mutation | TCG,TGG | S,W 141 | XP_016856567.1 | |
XM_017001079.1 | 1850 | Missense Mutation | TCG,TGG | S,W 141 | XP_016856568.1 |