Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGTGCTGAGGACAGGGCCTTCATG[A/G]AATGTATAAGTGCTATCCCCCCGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 609738 MIM: 608589 | ||||||||||||||||||||
Literature Links: |
IGSF9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IGSF9 - immunoglobulin superfamily member 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC01133 - long intergenic non-protein coding RNA 1133 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLAMF9 - SLAM family member 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146172.1 | 654 | Intron | NP_001139644.1 | |||
NM_001146173.1 | 654 | Intron | NP_001139645.1 | |||
NM_033438.3 | 654 | Silent Mutation | NP_254273.2 | |||
XM_017002756.1 | 654 | Silent Mutation | XP_016858245.1 |