Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGTCCCTTGAACACACATGCTGCC[A/G]AGCTCTGGAAAAACCCCACAGGTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611388 MIM: 191039 MIM: 605574 | ||||||||||||||||||||
Literature Links: |
DNTTIP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNTTIP1 - deoxynucleotidyltransferase, terminal, interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNNC2 - troponin C2, fast skeletal type | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBE2C - ubiquitin conjugating enzyme E2 C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001281741.1 | 617 | Intron | NP_001268670.1 | |||
NM_001281742.1 | 617 | Intron | NP_001268671.1 | |||
NM_007019.3 | 617 | Intron | NP_008950.1 | |||
NM_181799.2 | 617 | Intron | NP_861515.1 | |||
NM_181800.2 | 617 | Intron | NP_861516.1 | |||
NM_181801.3 | 617 | Missense Mutation | AAG,GAG | K,E 115 | NP_861517.1 |