Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGCTCACCGCTGCTTACGCTCCGC[C/T]TGCTGGAGCCGCCGGGAGAGGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 116949 MIM: 117140 MIM: 610674 | ||||||||||||||||||||
Literature Links: |
C20orf27 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C20orf27 - chromosome 20 open reading frame 27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CDC25B - cell division cycle 25B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CENPB - centromere protein B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPEF1 - sperm flagellar 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015417.4 | 817 | Silent Mutation | CAA,CAG | Q,Q 230 | NP_056232.2 | |
XM_005260683.4 | 817 | UTR 3 | XP_005260740.1 |