Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAATTTTTGTCAACATAAATATGA[A/G]TAACTCCTCCATGTTTATTACATTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603485 MIM: 604739 | ||||||||||||||||||||
Literature Links: |
NFS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NFS1 - NFS1 cysteine desulfurase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RBM39 - RNA binding motif protein 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242599.1 | Intron | NP_001229528.1 | ||||
NM_001242600.1 | Intron | NP_001229529.1 | ||||
NM_001323422.1 | Intron | NP_001310351.1 | ||||
NM_001323423.1 | Intron | NP_001310352.1 | ||||
NM_001323424.1 | Intron | NP_001310353.1 | ||||
NM_004902.3 | Intron | NP_004893.1 | ||||
NM_184234.2 | Intron | NP_909122.1 | ||||
XM_006723890.3 | Intron | XP_006723953.1 | ||||
XM_006723891.3 | Intron | XP_006723954.1 | ||||
XM_011529111.2 | Intron | XP_011527413.1 | ||||
XM_017028138.1 | Intron | XP_016883627.1 | ||||
XM_017028139.1 | Intron | XP_016883628.1 | ||||
XM_017028140.1 | Intron | XP_016883629.1 | ||||
XM_017028141.1 | Intron | XP_016883630.1 | ||||
XM_017028142.1 | Intron | XP_016883631.1 | ||||
XM_017028143.1 | Intron | XP_016883632.1 | ||||
XM_017028144.1 | Intron | XP_016883633.1 | ||||
XM_017028145.1 | Intron | XP_016883634.1 | ||||
XM_017028146.1 | Intron | XP_016883635.1 | ||||
XM_017028147.1 | Intron | XP_016883636.1 |
ROMO1 - reactive oxygen species modulator 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |