Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGCAGCCATGGCCAGCTCCAGGC[A/G]AGGCCTCCTGCTCCTGCTGCTGCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602352 MIM: 611988 MIM: 176884 | ||||||||||||||||||||
Literature Links: |
GNRH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GNRH2 - gonadotropin releasing hormone 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001310220.1 | 68 | Missense Mutation | CAA,CGA | Q,R 6 | NP_001297149.1 | |
NM_001501.1 | 68 | Missense Mutation | CAA,CGA | Q,R 6 | NP_001492.1 | |
NM_178331.1 | 68 | Missense Mutation | CAA,CGA | Q,R 6 | NP_847901.1 | |
NM_178332.1 | 68 | Missense Mutation | CAA,CGA | Q,R 6 | NP_847902.1 | |
XM_017027823.1 | 68 | Missense Mutation | CAA,CGA | Q,R 6 | XP_016883312.1 |
MRPS26 - mitochondrial ribosomal protein S26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPRA - protein tyrosine phosphatase, receptor type A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |