Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCACCATCCACTCGATGCCCTCG[C/T]GCACCCCTTTGCTGTGAAGACAGCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604699 MIM: 608833 MIM: 603361 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARFRP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARFRP1 - ADP ribosylation factor related protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134758.3 | 678 | UTR 3 | NP_001128230.1 | |||
NM_001267544.2 | 678 | UTR 3 | NP_001254473.1 | |||
NM_001267545.2 | 678 | UTR 3 | NP_001254474.1 | |||
NM_001267546.2 | 678 | Missense Mutation | CAC,CGC | H,R 130 | NP_001254475.1 | |
NM_001267547.2 | 678 | Missense Mutation | CAC,CGC | H,R 177 | NP_001254476.1 | |
NM_001267548.2 | 678 | Missense Mutation | CAC,CGC | H,R 177 | NP_001254477.1 | |
NM_001267549.2 | 678 | UTR 3 | NP_001254478.1 | |||
NM_003224.5 | 678 | Missense Mutation | CAC,CGC | H,R 177 | NP_003215.1 | |
XM_011528482.2 | 678 | Missense Mutation | CAC,CGC | H,R 177 | XP_011526784.1 | |
XM_011528483.1 | 678 | Missense Mutation | CAC,CGC | H,R 177 | XP_011526785.1 | |
XM_017027576.1 | 678 | Missense Mutation | CAC,CGC | H,R 177 | XP_016883065.1 |
RTEL1 - regulator of telomere elongation helicase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RTEL1-TNFRSF6B - RTEL1-TNFRSF6B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF6B - TNF receptor superfamily member 6b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZGPAT - zinc finger CCCH-type and G-patch domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |