Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTTCATTAATTACAAAATTACCTT[A/G]CATTTCTTTTTTCCACATCAGAACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604297 | ||||||||||||||||||||
Literature Links: |
PAXBP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PAXBP1 - PAX3 and PAX7 binding protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013329.3 | 2823 | Intron | NP_037461.2 | |||
NM_016631.3 | 2823 | Missense Mutation | GCA,GTA | A,V 878 | NP_057715.2 | |
XM_006724066.1 | 2823 | Missense Mutation | GCA,GTA | A,V 843 | XP_006724129.1 | |
XM_011529804.2 | 2823 | Intron | XP_011528106.1 |
PAXBP1-AS1 - PAXBP1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYNJ1 - synaptojanin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |