Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGGGCCAACAGGGGCATCGGCTT[G/T]GCCATCGCGCGCGAACTGTGCCGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603608 | ||||||||||||||||||||
Literature Links: |
CBR3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CBR3 - carbonyl reductase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001236.3 | 349 | Missense Mutation | TTG,TTT | L,F 19 | NP_001227.1 | |
XM_011529772.2 | 349 | Missense Mutation | TTG,TTT | L,F 19 | XP_011528074.1 |
CBR3-AS1 - CBR3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100133286 - uncharacterized LOC100133286 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |