Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGTATCTTTCAGGCTTCTGGGAA[C/T]TTGGCAGACGCAGCTTAGAGAGACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600237 MIM: 605089 | ||||||||||||||||||||
Literature Links: |
C22orf39 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C22orf39 - chromosome 22 open reading frame 39 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIRA - histone cell cycle regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL40 - mitochondrial ribosomal protein L40 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318151.1 | 718 | UTR 5 | NP_001305080.1 | |||
NM_001318152.1 | 718 | UTR 5 | NP_001305081.1 | |||
NM_003776.3 | 718 | Missense Mutation | ACT,ATT | T,I 22 | NP_003767.2 |