Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATTTGTCTTTACCTCAGGATAGAT[G/T]CCGATCAGCGCGTCGGCTCTGGAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608685 | ||||||||||||||||||||
Literature Links: |
FAM118A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM118A - family with sequence similarity 118 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMC1B - structural maintenance of chromosomes 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291501.1 | 3646 | Silent Mutation | GGA,GGC | G,G 1124 | NP_001278430.1 | |
NM_148674.4 | 3646 | Silent Mutation | GGA,GGC | G,G 1198 | NP_683515.4 | |
XM_011530144.2 | 3646 | Silent Mutation | GGA,GGC | G,G 1157 | XP_011528446.1 | |
XM_011530145.2 | 3646 | Intron | XP_011528447.1 |