Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCAGGAGCACTCACAGGGCCAAA[A/G]CCACCTCCAGCGCCCAGGTGATTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612395 MIM: 601987 MIM: 615775 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHKB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHKB - choline kinase beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHKB-CPT1B - CHKB-CPT1B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CPT1B - carnitine palmitoyltransferase 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145134.1 | 2271 | Silent Mutation | GGC,GGT | G,G 677 | NP_001138606.1 | |
NM_001145135.1 | 2271 | Silent Mutation | GGC,GGT | G,G 711 | NP_001138607.1 | |
NM_001145137.1 | 2271 | Silent Mutation | GGC,GGT | G,G 711 | NP_001138609.1 | |
NM_004377.3 | 2271 | Silent Mutation | GGC,GGT | G,G 711 | NP_004368.1 | |
NM_152245.2 | 2271 | Silent Mutation | GGC,GGT | G,G 711 | NP_689451.1 | |
NM_152246.2 | 2271 | Silent Mutation | GGC,GGT | G,G 711 | NP_689452.1 |
SYCE3 - synaptonemal complex central element protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |