Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAAATCATGTGCATATTGGAAAAC[C/T]GGAAAAAGAGGGATAGGAAAAATCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608685 | ||||||||||||||||||||
Literature Links: |
RIBC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
RIBC2 - RIB43A domain with coiled-coils 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015653.4 | 280 | Missense Mutation | CGG,TGG | R,W 87 | NP_056468.3 | |
XM_005261524.4 | 280 | Missense Mutation | CGG,TGG | R,W 14 | XP_005261581.1 | |
XM_011530126.2 | 280 | Intron | XP_011528428.1 | |||
XM_017028766.1 | 280 | Missense Mutation | CGG,TGG | R,W 87 | XP_016884255.1 |
SMC1B - structural maintenance of chromosomes 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |