Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCGCCAAGAGGCTCACCCACAA[C/T]TGGAAGACTGCCTGGGCATCGGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602332 MIM: 601664 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ITPRIPL1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ITPRIPL1 - inositol 1,4,5-trisphosphate receptor interacting protein-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001008949.2 | 972 | Silent Mutation | CTG,TTG | L,L 213 | NP_001008949.1 | |
NM_001163523.1 | 972 | Silent Mutation | CTG,TTG | L,L 205 | NP_001156995.1 | |
NM_001163524.1 | 972 | Silent Mutation | CTG,TTG | L,L 205 | NP_001156996.1 | |
NM_001324490.1 | 972 | Silent Mutation | CTG,TTG | L,L 205 | NP_001311419.1 | |
NM_178495.5 | 972 | Silent Mutation | CTG,TTG | L,L 221 | NP_848590.3 | |
XM_017003427.1 | 972 | Silent Mutation | CTG,TTG | L,L 213 | XP_016858916.1 |
LOC105373495 - uncharacterized LOC105373495 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NCAPH - non-SMC condensin I complex subunit H | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNRNP200 - small nuclear ribonucleoprotein U5 subunit 200 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |