Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCCTGTCTGGCCCTGCGCATGGC[A/G]CTGCTGCTGGTCTCCGGGGTTCTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612003 MIM: 605991 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C2orf82 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C2orf82 - chromosome 2 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_206895.1 | 151 | Silent Mutation | GCA,GCG | A,A 10 | NP_996778.1 | |
XM_017004080.1 | 151 | Silent Mutation | GCA,GCG | A,A 109 | XP_016859569.1 | |
XM_017004081.1 | 151 | Silent Mutation | GCA,GCG | A,A 10 | XP_016859570.1 | |
XM_017004082.1 | 151 | Silent Mutation | GCA,GCG | A,A 10 | XP_016859571.1 | |
XM_017004083.1 | 151 | Silent Mutation | GCA,GCG | A,A 10 | XP_016859572.1 | |
XM_017004084.1 | 151 | Silent Mutation | GCA,GCG | A,A 10 | XP_016859573.1 |
GIGYF2 - GRB10 interacting GYF protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NGEF - neuronal guanine nucleotide exchange factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |