Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCCACCCTTTCCTCTAACCTTG[A/T]GAAAGTATCCTGACACCAGTGCTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602434 MIM: 606441 MIM: 604240 | ||||||||||||||||||||
Literature Links: |
AUP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AUP1 - ancient ubiquitous protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DQX1 - DEAQ-box RNA dependent ATPase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_133637.2 | 1255 | Missense Mutation | CAC,CTC | H,L 601 | NP_598376.2 | |
XM_011532644.1 | 1255 | Missense Mutation | CAC,CTC | H,L 483 | XP_011530946.1 | |
XM_011532645.1 | 1255 | Missense Mutation | CAC,CTC | H,L 359 | XP_011530947.1 | |
XM_011532646.2 | 1255 | Intron | XP_011530948.1 | |||
XM_017003520.1 | 1255 | Missense Mutation | CAC,CTC | H,L 269 | XP_016859009.1 |
HTRA2 - HtrA serine peptidase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLX2 - T-cell leukemia homeobox 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |