Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGAGCCGATGCCGAGCTGCTCCAC[A/G]TCCACCATGCCGGGCATGATCTGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 164840 MIM: 605374 MIM: 615968 | ||||||||||||||||||||
Literature Links: |
MYCN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MYCN - v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001293228.1 | 751 | Silent Mutation | ACA,ACG | T,T 6 | NP_001280157.1 | |
NM_001293231.1 | 751 | Intron | NP_001280160.1 | |||
NM_001293233.1 | 751 | Missense Mutation | ATC,GTC | I,V 98 | NP_001280162.1 | |
NM_005378.5 | 751 | Silent Mutation | ACA,ACG | T,T 6 | NP_005369.2 | |
XM_017004168.1 | 751 | Silent Mutation | ACA,ACG | T,T 6 | XP_016859657.1 |
MYCNOS - MYCN opposite strand | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYCNUT - MYCN upstream transcript (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |