Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCCCAGGCCCCTCCCAGGATGAC[C/T]CCTTGCATCCTCTCAATAAGCTTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
NOTO PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NOTO - notochord homeobox | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRADC1 - protease associated domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMYD5 - SMYD family member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006062.2 | 2179 | Missense Mutation | CCC,TCC | P,S 144 | NP_006053.2 | |
XM_006711918.3 | 2179 | Missense Mutation | CCC,TCC | P,S 92 | XP_006711981.1 | |
XM_017003163.1 | 2179 | Missense Mutation | CCC,TCC | P,S 156 | XP_016858652.1 |