Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTGTGTGAGGCCTGGGCCAGGCTG[C/T]GGCACCACCAGCAAGTCACCCTGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616431 | ||||||||||||||||||||
Literature Links: |
FAHD2CP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAHD2CP - fumarylacetoacetate hydrolase domain containing 2C, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPAT2 - glycerol-3-phosphate acyltransferase 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321525.1 | Intron | NP_001308454.1 | ||||
NM_001321526.1 | Intron | NP_001308455.1 | ||||
NM_001321527.1 | Intron | NP_001308456.1 | ||||
NM_001321528.1 | Intron | NP_001308457.1 | ||||
NM_001321529.1 | Intron | NP_001308458.1 | ||||
NM_001321530.1 | Intron | NP_001308459.1 | ||||
NM_001321531.1 | Intron | NP_001308460.1 | ||||
NM_207328.3 | Intron | NP_997211.2 | ||||
XM_005263888.3 | Intron | XP_005263945.1 | ||||
XM_006712308.3 | Intron | XP_006712371.1 | ||||
XM_006712311.3 | Intron | XP_006712374.1 | ||||
XM_006712312.3 | Intron | XP_006712375.1 | ||||
XM_006712313.3 | Intron | XP_006712376.1 | ||||
XM_017003424.1 | Intron | XP_016858913.1 | ||||
XM_017003425.1 | Intron | XP_016858914.1 | ||||
XM_017003426.1 | Intron | XP_016858915.1 |
LOC107984110 - fumarylacetoacetate hydrolase domain-containing protein 2B-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |