Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCCCCAGGCCCAGATTGCCCCCC[A/G]GCCAGCCAGCCGCCACAGGTAAGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615900 MIM: 130660 MIM: 614058 | ||||||||||||||||||||
Literature Links: |
AGBL5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGBL5 - ATP/GTP binding protein like 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EMILIN1 - elastin microfibril interfacer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007046.3 | 651 | Missense Mutation | CAG,CGG | Q,R 51 | NP_008977.1 |
KHK - ketohexokinase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OST4 - oligosaccharyltransferase complex subunit 4, non-catalytic | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |