Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTAATACCGTCTGCAGGACCTTTT[C/T]TCTGGAGGGGCTGGCATCAACCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611787 | ||||||||||||||||||||
Literature Links: |
CMPK2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CMPK2 - cytidine/uridine monophosphate kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256477.1 | 1417 | Intron | NP_001243406.1 | |||
NM_001256478.1 | 1417 | Intron | NP_001243407.1 | |||
NM_207315.3 | 1417 | Missense Mutation | AAA,GAA | K,E 432 | NP_997198.2 |
NRIR - negative regulator of interferon response (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |