Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAGAATGGTCTGGACCTTCAGGA[C/T]TGTCCTGATACGGTATCAGATCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604883 MIM: 137960 | ||||||||||||||||||||
Literature Links: |
GTF3C2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GTF3C2 - general transcription factor IIIC subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001035521.2 | 3037 | Missense Mutation | NP_001030598.1 | |||
NM_001318909.1 | 3037 | Missense Mutation | NP_001305838.1 | |||
NM_001521.3 | 3037 | Missense Mutation | NP_001512.1 | |||
XM_005264272.4 | 3037 | Missense Mutation | XP_005264329.1 | |||
XM_011532801.2 | 3037 | Missense Mutation | XP_011531103.1 |
GTF3C2-AS1 - GTF3C2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPV17 - MPV17, mitochondrial inner membrane protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |