Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCCTCACGACCCGGGTAGTCTTA[C/G]GACCCTGGTGCCCTGGGCTGCCGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 114010 MIM: 604024 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATRAID PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATRAID - all-trans retinoic acid induced differentiation factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001170795.1 | 367 | Missense Mutation | ACG,AGG | T,R 10 | NP_001164266.1 | |
NM_016085.4 | 367 | UTR 5 | NP_057169.2 | |||
NM_080592.3 | 367 | Missense Mutation | ACG,AGG | T,R 65 | NP_542159.3 |
CAD - carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC5A6 - solute carrier family 5 member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021095.2 | 367 | Intron | NP_066918.2 | |||
XM_006712128.1 | 367 | Intron | XP_006712191.1 | |||
XM_006712129.1 | 367 | Intron | XP_006712192.1 | |||
XM_006712130.1 | 367 | Intron | XP_006712193.1 | |||
XM_011533146.2 | 367 | Intron | XP_011531448.1 | |||
XM_017005216.1 | 367 | Intron | XP_016860705.1 |