Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTATATGTGACCCCTGAGGTCACAG[A/G]ATGAATAGATCACCAAGAGTATGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602434 MIM: 606441 MIM: 607163 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AUP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AUP1 - ancient ubiquitous protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DQX1 - DEAQ-box RNA dependent ATPase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HTRA2 - HtrA serine peptidase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321727.1 | 2553 | Missense Mutation | GAA,GGA | E,G 436 | NP_001308656.1 | |
NM_001321728.1 | 2553 | Missense Mutation | GAA,GGA | E,G 426 | NP_001308657.1 | |
NM_013247.4 | 2553 | Missense Mutation | GAA,GGA | E,G 458 | NP_037379.1 | |
NM_145074.2 | 2553 | Missense Mutation | GAA,GGA | E,G 361 | NP_659540.1 |
LOXL3 - lysyl oxidase like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001289164.1 | 2553 | UTR 3 | NP_001276093.1 | |||
NM_001289165.1 | 2553 | UTR 3 | NP_001276094.1 | |||
NM_032603.3 | 2553 | UTR 3 | NP_115992.1 | |||
XM_011533134.2 | 2553 | Intron | XP_011531436.1 | |||
XM_017005112.1 | 2553 | Intron | XP_016860601.1 |