Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTCTTAGGAAGAAGAAAAGGATT[A/T]TAAAGGCCCTAATCCAAGAGAGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605760 MIM: 611229 | ||||||||||||||||||||
Literature Links: |
ASB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASB3 - ankyrin repeat and SOCS box containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ERLEC1 - endoplasmic reticulum lectin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001127397.2 | 564 | Missense Mutation | TAT,TTT | Y,F 95 | NP_001120869.1 | |
NM_001127398.2 | 564 | Missense Mutation | TAT,TTT | Y,F 95 | NP_001120870.1 | |
NM_015701.4 | 564 | Missense Mutation | TAT,TTT | Y,F 95 | NP_056516.2 | |
XM_011532766.1 | 564 | Missense Mutation | TAT,TTT | Y,F 95 | XP_011531068.1 |
GPR75-ASB3 - GPR75-ASB3 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164165.1 | 564 | Intron | NP_001157637.1 |