Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAGTCCTCCTCGTCCCAGAGCGT[A/G]AGGCTGGCGGGCGCCGGGCCCGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614270 MIM: 600836 MIM: 607150 MIM: 611173 | ||||||||||||||||||||
Literature Links: |
CFAP65 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFAP65 - cilia and flagella associated protein 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CRYBA2 - crystallin beta A2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_057093.1 | 77 | Silent Mutation | CTC,CTT | L,L 14 | NP_476434.1 | |
NM_057094.1 | 77 | Silent Mutation | CTC,CTT | L,L 14 | NP_476435.1 |
FEV - FEV, ETS transcription factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100129175 - uncharacterized LOC100129175 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR375 - microRNA 375 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |