Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGAACCTGCTCCTAGCCCTGGGCA[C/T]CGCCTGGGACCGCCGCCTGCGCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603488 MIM: 604224 MIM: 610147 MIM: 609023 | ||||||||||||||||||||
Literature Links: |
AAMP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AAMP - angio associated migratory cell protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ARPC2 - actin related protein 2/3 complex subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPBAR1 - G protein-coupled bile acid receptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077191.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | NP_001070659.1 | |
NM_001077194.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | NP_001070662.1 | |
NM_001321950.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | NP_001308879.1 | |
NM_170699.2 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | NP_733800.1 | |
XM_011510743.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | XP_011509045.1 | |
XM_017003467.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | XP_016858956.1 | |
XM_017003468.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | XP_016858957.1 | |
XM_017003469.1 | 1701 | Missense Mutation | ACC,ATC | T,I 39 | XP_016858958.1 |
PNKD - paroxysmal nonkinesigenic dyskinesia | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |