Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTGGAACCTTCCTTTTGGAGGGA[A/T]CCCTCAGCAGCGACAAGATACTTTC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608750 MIM: 610145 MIM: 611620 | |||||||||||||||||||||||
Literature Links: |
ALG3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ALG3 - ALG3, alpha-1,3- mannosyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001006941.2 | 881 | Missense Mutation | GAT,GTT | D,V 274 | NP_001006942.1 | |
NM_005787.5 | 881 | Missense Mutation | GAT,GTT | D,V 322 | NP_005778.1 | |
XM_011512322.1 | 881 | Missense Mutation | GAT,GTT | D,V 289 | XP_011510624.1 | |
XM_011512323.2 | 881 | Missense Mutation | GAT,GTT | D,V 282 | XP_011510625.1 |
ECE2 - endothelin converting enzyme 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1224 - microRNA 1224 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VWA5B2 - von Willebrand factor A domain containing 5B2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |