Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCCACTGGTGTCAGCAGCTCCCCA[G/T]GGCTCGCCGTCTGCCCCTGCCCCTC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 602410 MIM: 604998 MIM: 601982 | |||||||||||||||||||||||
Literature Links: |
BRPF1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
BRPF1 - bromodomain and PHD finger containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CAMK1 - calcium/calmodulin dependent protein kinase I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003656.4 | 1057 | Missense Mutation | CAT,CCT | H,P 334 | NP_003647.1 | |
XM_005265516.1 | 1057 | Missense Mutation | CAT,CCT | H,P 334 | XP_005265573.1 | |
XM_005265517.2 | 1057 | Missense Mutation | CAT,CCT | H,P 290 | XP_005265574.1 | |
XM_017007354.1 | 1057 | Missense Mutation | CAT,CCT | H,P 290 | XP_016862843.1 |
OGG1 - 8-oxoguanine DNA glycosylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002542.5 | 1057 | Intron | NP_002533.1 | |||
NM_016819.3 | 1057 | Intron | NP_058212.1 | |||
NM_016820.3 | 1057 | Intron | NP_058213.1 | |||
NM_016821.2 | 1057 | Intron | NP_058214.1 | |||
NM_016826.2 | 1057 | Intron | NP_058434.1 | |||
NM_016827.2 | 1057 | Intron | NP_058436.1 | |||
NM_016828.2 | 1057 | Intron | NP_058437.1 | |||
NM_016829.2 | 1057 | Intron | NP_058438.1 | |||
XM_011533760.1 | 1057 | Intron | XP_011532062.1 | |||
XM_017006493.1 | 1057 | Intron | XP_016861982.1 | |||
XM_017006494.1 | 1057 | Intron | XP_016861983.1 | |||
XM_017006495.1 | 1057 | Intron | XP_016861984.1 | |||
XM_017006496.1 | 1057 | Intron | XP_016861985.1 | |||
XM_017006497.1 | 1057 | Intron | XP_016861986.1 | |||
XM_017006498.1 | 1057 | Intron | XP_016861987.1 | |||
XM_017006499.1 | 1057 | Intron | XP_016861988.1 |