Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCAGGCTCGGTTACTAGGAACACT[A/G]GCTGTCTCCCGGGGCCTGGGAGACC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608979 MIM: 607433 MIM: 611059 | |||||||||||||||||||||||
Literature Links: |
LOC101929054 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LOC101929054 - uncharacterized LOC101929054 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPM1M - protein phosphatase, Mg2+/Mn2+ dependent 1M | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122870.2 | 920 | Silent Mutation | CTA,CTG | L,L 121 | NP_001116342.1 | |
NM_144641.3 | 920 | Silent Mutation | CTA,CTG | L,L 333 | NP_653242.3 | |
XM_005264879.2 | 920 | Silent Mutation | CTA,CTG | L,L 333 | XP_005264936.1 | |
XM_005264880.3 | 920 | Silent Mutation | CTA,CTG | L,L 248 | XP_005264937.1 | |
XM_005264881.1 | 920 | Silent Mutation | CTA,CTG | L,L 172 | XP_005264938.1 |
TWF2 - twinfilin actin binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR82 - WD repeat domain 82 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |