Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGGCACCTTCGGGCCCTCCTGC[C/T]TTCGTGAGTTTTTAAGTTGCTCTTG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 607170 MIM: 610925 | |||||||||||||||||||||||
Literature Links: |
CRELD1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CRELD1 - cysteine rich with EGF like domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031717.3 | 556 | Missense Mutation | CTT,TTT | L,F 153 | NP_001026887.1 | |
NM_001077415.2 | 556 | Missense Mutation | CTT,TTT | L,F 153 | NP_001070883.1 | |
NM_015513.4 | 556 | Missense Mutation | CTT,TTT | L,F 153 | NP_056328.2 | |
XM_011534108.1 | 556 | Missense Mutation | CTT,TTT | L,F 153 | XP_011532410.1 | |
XM_017007175.1 | 556 | Missense Mutation | CTT,TTT | L,F 153 | XP_016862664.1 |
IL17RC - interleukin 17 receptor C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRRT3 - proline rich transmembrane protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRRT3-AS1 - PRRT3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |