Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCACTCCAGTCCAAGCCTGGAA[C/T]TCCTGTCTGGAACAGAGAACACGGT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 610593 MIM: 607858 MIM: 613373 | |||||||||||||||||||||||
Literature Links: |
MAP6D1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
MAP6D1 - MAP6 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024871.2 | 466 | Silent Mutation | GAA,GAG | E,E 136 | NP_079147.1 |
PARL - presenilin associated rhomboid like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YEATS2 - YEATS domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |