Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGTCCTCTCAATGAAGACAATGG[A/G]TGCAAAGGGAACCTGATGGAAGCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603727 MIM: 614471 | ||||||||||||||||||||
Literature Links: |
MIR6890 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6890 - microRNA 6890 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
QARS - glutaminyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272073.1 | 1904 | Missense Mutation | CCC,TCC | P,S 599 | NP_001259002.1 | |
NM_005051.2 | 1904 | Missense Mutation | CCC,TCC | P,S 610 | NP_005042.1 | |
XM_017006965.1 | 1904 | Missense Mutation | CCC,TCC | P,S 628 | XP_016862454.1 |
QRICH1 - glutamine rich 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP19 - ubiquitin specific peptidase 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |