Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAATCTTCCTGGAGGTCCTAGAAA[G/T]CTCAGGTATTCCTGCTGGAGCAAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612859 | ||||||||||||||||||||
Literature Links: |
TIGIT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
TIGIT - T-cell immunoreceptor with Ig and ITIM domains | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173799.3 | 462 | Missense Mutation | AGC,ATC | S,I 129 | NP_776160.2 | |
XM_011512538.1 | 462 | Missense Mutation | AGC,ATC | S,I 129 | XP_011510840.1 | |
XM_017005865.1 | 462 | Intron | XP_016861354.1 |