Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTGGCGCTGCCGCCCACCTTGTG[G/T]CCCTGGGCTTTACCATCTTTGTGGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 607068 MIM: 607072 MIM: 607069 MIM: 607070 | |||||||||||||||||||||||
Literature Links: |
CYB561D2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CYB561D2 - cytochrome b561 family member D2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291284.1 | 460 | Missense Mutation | GCC,TCC | A,S 27 | NP_001278213.1 | |
NM_007022.4 | 460 | Missense Mutation | GCC,TCC | A,S 27 | NP_008953.1 |
NPRL2 - NPR2-like, GATOR1 complex subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006545.4 | 460 | Intron | NP_006536.3 | |||
XM_005264808.4 | 460 | Intron | XP_005264865.1 | |||
XM_011533288.2 | 460 | Intron | XP_011531590.1 | |||
XM_017005555.1 | 460 | Intron | XP_016861044.1 | |||
XM_017005556.1 | 460 | Intron | XP_016861045.1 |
TMEM115 - transmembrane protein 115 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZMYND10 - zinc finger MYND-type containing 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |